rs3766270 chr1:67749741 C>T
- Sequence
ccatctccacaggctatcggcatt[C/T]ccagtgggatgcaccacagcccca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 2.90 | -0.71 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | 1.26 | -0.34 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, hip bone mineral density (bmd), ldl cholesterol change with statins, microalbuminuria, paternal transmission distortion, transmission distortion