rs3766684 chr1:175187328 C>T
- Sequence
gtttactgtgggttccaaatcact[C/T]ggaaggtcactttgaccccagcat
- ASB in cell types
- LY-2 (invasive ductal carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LY-2 (invasive ductal carcinoma) | n/a | 3.22 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 1.03 | 0.14 | 1.59 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood