rs3767169 chr1:180188458 G>A
- Sequence
tctggcactgtcgccttagaaggc[G/A]gaagtttctaagtcaggatgatgg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) foreskin keratinocyte Peyer's patch Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.46 | 1.46 | 1.00 | |||
| foreskin keratinocyte | n/a | 1.20 | 2.83 | |||
| Peyer's patch | 1.33 | -1.36 | 1.50 | |||
| Kelly (neuroblastoma) | 0.08 | 1.38 | 2.00 | |||
| HuCCT1 (intrahepatic cholangiocarcinoma) | 2.52 | -1.55 | 2.00 |
Items per page:
1 – 5 of 5