rs3767170 chr1:180188432 C>T
- Sequence
ccagagctccttaattcatccatc[C/T]ttctggcactgtcgccttagaagg
- ASB in cell types
- Kelly (neuroblastoma) WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- MEIS2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.49 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, resistance to kuru in aged women despite likely exposure, stabilized warfarin dose, tetrology of fallot
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Substantia_nigra, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Spleen, Stomach, Thyroid, Whole_Blood