rs3768580 chr1:16947843 G>T
- Sequence
gtttcattttgttttgtttttgtt[G/T]ttgtttttttttccagacagagtc
- ASB in cell types
- H929 (plasma cell myeloma) HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | n/a | 3.14 | 1.00 | |||
| HEK293 (embryonic kidney) | -0.22 | 0.89 | 2.00 | |||
| bipolar neuron | -1.41 | 1.66 | 1.00 |
Items per page:
1 – 3 of 3