rs3768581 chr1:16947824 A>G
- Sequence
gagggccctcattttttttgtttc[A/G]ttttgttttgtttttgttgttgtt
- ASB in cell types
- HEK293 (embryonic kidney) H929 (plasma cell myeloma) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.17 | 1.32 | 2.00 | |||
| H929 (plasma cell myeloma) | -2.92 | 2.81 | 1.00 | |||
| glioblastoma cells | 2.60 | -1.82 | 2.00 |
Items per page:
1 – 3 of 3