rs3768729 chr2:46364867 T>C
- Sequence
tactgtgcatctgctatgtaactg[T/C]gtgccagagaccattacatcaaag
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.85 | 0.56 | 1.32 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hemoglobin (hb), lp-pla2 activity, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (males), renal cell carcinoma (renal cancer), tetrology of fallot