rs3769185 chr2:173148771 A>G
- Sequence
atggaatgtcccttactgaatttc[A/G]tggtttgccaaatttggcagagtt
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- BRD4_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -0.33 | 1.77 | 1.06 | n/a | n/a | |||
| SRF_HUMAN | n/a | 2.49 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als), amyotrophic lateral sclerosis (als) with c9orf72 hexanucleotide repeat mutations, amyotrophic lateral sclerosis (als) without c9orf72 hexanucleotide repeat mutations, college completion, height, hip bone mineral density (bmd), hypertension (early onset hypertension), maternal transmission distortion, myocardial infarction (mi), spine bone mineral density (bmd), sporadic amyotrophic lateral sclerosis (als), transmission distortion, years of education