rs3769211 chr2:173049830 G>T
- Sequence
atgtgttttcatctattaatttac[G/T]ttgtgtttaaagatgtgatcataa
- ASB in cell types
- HEK293 (embryonic kidney) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.16 | 0.41 | 1.05 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 2.21 | -1.75 | 2.00 |
Items per page:
1 – 2 of 2