rs3769249 chr2:172957934 G>A
- Sequence
gggttccaaggaaccagaaaggga[G/A]ctgtccaacaaaataaagtagcct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) Jurkat (T-cells)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 3.14 | -0.92 | 1.25 | -1.69 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, bipolar disorder, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, infant head circumference, total cholesterol