rs3769254 chr2:172932107 G>A
- Sequence
tgggctccctctggtggtcattcc[G/A]gtgttcatgcatgtctaaccttca
- ASB in cell types
- A549 (lung carcinoma) hepatocytes THP-1 (acute monocytic leukemia) WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.42 | 0.94 | 2.05 | |||
| hepatocytes | -0.63 | 1.21 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.61 | 0.98 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.51 | -0.19 | 1.86 | |||
| erythroid progenitors | n/a | 2.15 | 2.50 |
Items per page:
1 – 5 of 6