rs3770115 chr2:181499946 G>A
- Sequence
tttagtcctgtgtttcttggcatc[G/A]ttcctgtaaataagggatcatcaa
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.02 | 0.13 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting blood glucose, ldl cholesterol change with statins, mitral annular calcium, total cholesterol change with statins