rs3770455 chr2:171811385 G>A
- Sequence
ggcagtattaactttctaaccctc[G/A]tgattatcaggctctattactttt
- ASB in cell types
- A549 (lung carcinoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.21 | 0.88 | 2.04 | |||
| upper lobe of left lung | -1.64 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2