rs3770925 chr2:36404065 C>G
- Sequence
aagtgactggcaatgttaacacac[C/G]aagagtgataccaagtgtatctta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.68 | 1.79 | 1.38 | |||
| A549 (lung carcinoma) | 0.41 | 0.77 | 1.21 |
Items per page:
1 – 2 of 2