rs3771130 chr2:10408700 T>C
- Sequence
ctggcagcgttctcaggctagccc[T/C]ccctgctgaaaagagaaccgtgtg
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.56 | 2.73 | 1.23 | 4.10 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
