rs3771382 chr2:71332315 C>G
- Sequence
tgccgagcagggaggaagcgttcc[C/G]gtcgggcccgaagaggcggtggag
- ASB in cell types
- K562 (myelogenous leukemia) RCH-ACV (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
- ASB for transcription factors
- TYY1_HUMAN KMT2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.18 | 0.03 | 1.57 | n/a | No Hit | |||
| KMT2A_HUMAN | 2.11 | -0.11 | 1.17 | -0.34 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting blood glucose, height, ldl cholesterol, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid