rs3771808 chr2:75065098 G>A
- Sequence
tccaagtcctccggccccagatac[G/A]gaaatgtgaggcaggtaactgcca
- ASB in cell types
- MDM(monocyte derived macrophages) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.16 | 1.98 | 2.00 | |||
| gastroesophageal sphincter | -1.56 | 1.95 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, infant head circumference, neuroticism, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood