rs377185 chr4:123088784 G>C
- Sequence
tcctcttctccttcagccataatt[G/C]ttagtttcctgaggtctcccggtc
- ASB in cell types
- monocyte-derived dendritic cells CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | -0.44 | 2.22 | 1.33 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.03 | 0.20 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic