rs3772701 chr3:100261437 T>C
- Sequence
agaaggaagtttgttggatgcaga[T/C]ctgagtcactaaaatacaatgtga
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.41 | -1.65 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), alzheimers disease
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood