rs3773182 chr3:14453347 G>A
- Sequence
cttacctcggagtctcctccctct[G/A]tatgagacagacgaggaagctggg
- ASB in cell types
- HAEC (human aortic endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | 2.54 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), major depressive disorder (narrow definition) (males), parkinsons disease, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio