rs3773745 chr3:53236408 A>G
- Sequence
actccctgcagcctctcctgcctc[A/G]tactgctcttctgtggcctccacc
- ASB in cell types
- CD34+ hematopoietic stem cells
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | n/a | 3.76 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid