rs3774041 chr3:171646515 G>A
- Sequence
gccatgctaagaaacaaggatctt[G/A]agtaggttgttgtaatggcatgga
- ASB in cell types
- T47D (invasive ductal carcinoma) foreskin keratinocyte PC9 (lung adenocarcinoma) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.92 | -0.76 | 3.50 | |||
| foreskin keratinocyte | 1.05 | n/a | 2.33 | |||
| PC9 (lung adenocarcinoma) | -0.34 | 1.07 | 1.50 | |||
| erythroid progenitors | -1.48 | 2.43 | 2.00 | |||
| liver | 1.47 | -0.35 | 1.50 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, ldl cholesterol change with statins, refractive error, total cholesterol, total cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Lung, Spleen, Thyroid