rs3774045 chr3:171614780 C>A
- Sequence
tgaactgacatcactgctttgttt[C/A]gggtcaggagaacctgggatgtga
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.96 | 0.97 | 1.00 | |||
| WA09 (embryonic stem cells) | 1.92 | -0.34 | 1.29 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol, ldl cholesterol change with statins, refractive error, total cholesterol, total cholesterol change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Lung, Spleen, Thyroid