rs3774299 chr3:187742119 G>A
- Sequence
tcccctattttttttaaatctctg[G/A]gggaaaaatgtttcataagttcac
- ASB in cell types
- CD34+ stem cells-derived erythroblasts glioblastoma cells epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | n/a | 3.12 | 2.00 | |||
| glioblastoma cells | 1.01 | -2.21 | 1.33 | |||
| epidermal keratinocytes | 2.26 | n/a | 2.00 |
Items per page:
1 – 3 of 3