rs3774302 chr3:187740982 G>A
- Sequence
tggtcagggtaccgccgcccggga[G/A]gtggaacggcgagcccaccgccca
- ASB in cell types
- HEK293 (embryonic kidney) breast tumor
- ASB for transcription factors
- MAZ_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MAZ_HUMAN | -1.72 | 2.77 | 2.00 | -2.42 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
