rs3774581 chr3:53768721 A>G
- Sequence
ttactgaatttcagtttttctgtg[A/G]tatgctgaaaccccttattttctg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -2.48 | 2.81 | 1.00 | n/a | No Hit | |||
| RELB_HUMAN | -2.92 | 2.81 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, 2 hour insulin, alcohol consumption, bipolar disorder, hdl cholesterol, height, imprinting effects on cleft lip and cleft palate, ldl cholesterol change with statins, major depressive disorder, serum creatinine, triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Thyroid