rs3774715 chr3:63934200 T>C
- Sequence
ttgtgtcctgtcctttcatacttc[T/C]tgcctgctggcagcctcttccacc
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.38 | 2.00 | 2.12 | 4.45 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, hdl cholesterol, serum creatinine
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Spleen, Testis, Whole_Blood