rs3774883 chr4:5824870 A>G
- Sequence
ctcatgtggccatctcaccaaatc[A/G]cagatacactgccctgagacctta
- ASB in cell types
- D54 (H54, Human glioblastoma) GM12892 (female B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 1.17 | 1.46 | n/a | No Hit | |||
| RAD21_HUMAN | 0.63 | 1.26 | 1.27 | n/a | n/a |
Items per page:
1 – 2 of 2