rs3775230 chr4:87051057 G>C
- Sequence
ggctttttattgaaaaggagaagt[G/C]gaataagcagagatgggtatacca
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.21 | -0.57 | 1.35 | -0.76 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, hdl cholesterol, ldl cholesterol, total cholesterol, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg