rs377558 chr7:108146236 C>G
- Sequence
caaggctcacagggacacatgctt[C/G]ctccctggatgctgtggactcgtc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.54 | -0.03 | 1.48 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.67 | 0.97 | 1.02 |
Items per page:
1 – 2 of 2