rs3775587 chr4:173536991 C>G
- Sequence
caaggtacatctcagatcagatcc[C/G]tctgggaaaagcgcgggaatgctt
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 2.75 | -3.04 | 2.25 | |||
| MS-1 (Small cell lung carcinoma) | -1.38 | 1.38 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.44 | 1.82 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg