rs3777083 chr5:33442018 A>G
- Sequence
ttctatacatgaaggatcttaagc[A/G]ggaagattgtatttgtaaaagtca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.99 | 0.54 | 1.09 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, childhood acute lymphoblastic leukemia, major depressive disorder, variant creutzfeldt-jakob disease, years of education
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood