rs377722 chr1:16621256 G>C
- Sequence
aaggccatggggactgcagggtga[G/C]tggcatgccctggagccatgtagt
- ASB in cell types
- HT1080 (fibrosarcoma) T-ALL cells from peripheral blood HUVEC-C (HUVEC, umbilical vein endothelial cells) GBM39 (Human brain tumor)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.37 | -0.36 | 2.22 | n/a | No Hit |
Items per page:
1 – 1 of 1