rs3777554 chr6:45921243 T>C
- Sequence
tcttagaccacatgaagtcagaaa[T/C]ggcagcaaggttttagaagatggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.77 | 0.46 | 1.09 | |||
| MS-1 (Small cell lung carcinoma) | 1.56 | -0.75 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, diabetic retinopathy in type 2 diabetes mellitus, hip bone mineral density (bmd), hypertension (early onset hypertension), maternal transmission distortion, spine bone mineral density (bmd), years of education
GTEx eQTL Adipose_Subcutaneous, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Testis