rs3777556 chr6:45922904 T>C
- Sequence
ctgcagagctagcgagctcaggag[T/C]gatcaggggagaagttctggttag
- ASB in cell types
- KMS-11 (Plasma cell myeloma) thyroid gland CTV-1 (Adult T acute lymphoblastic leukemia) gastroesophageal sphincter
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -0.91 | 1.64 | 1.50 | -3.46 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
