rs3777557 chr6:45923032 T>C
- Sequence
aaaactccccaaaaacctattgtg[T/C]attttccacagagaacatgtacgt
- ASB in cell types
- Peyer's patch uterus
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -0.44 | 1.95 | 1.00 | |||
| uterus | -0.26 | 1.91 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis