rs3777921 chr6:111603207 A>G
- Sequence
tgctgggcacgggaggcaaagacc[A/G]taagtgggagaaaggacagcctga
- ASB in cell types
- hMADS-3 (adipose-derived stem cells) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hMADS-3 (adipose-derived stem cells) | -1.02 | 1.81 | 1.00 | |||
| iPS-derived dermal fibroblasts | 0.08 | 2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hdl cholesterol, height, prop taste detection threshold, refractive error, urinary albumin-to-creatinine ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid, Whole_Blood