rs3778677 chr7:80781788 C>T
- Sequence
aaattttccttacattcctatcac[C/T]agagggttaaataggggcaacact
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- TF65_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.48 | -0.34 | 1.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.14 | 1.23 | 1.68 | -0.16 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, irritible bowel syndrome, neuroblastoma (brain cancer), resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp)