rs3779802 chr8:86618882 G>A
- Sequence
tgctagaaagcatgctgccattcc[G/A]gttctcttcttggctcagtctgtc
- ASB in cell types
- bronchial epithelial cells
- ASB for transcription factors
- ESR1_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.81 | 1.37 | 1.80 | n/a | No Hit | |||
| GRHL2_HUMAN | 2.52 | -1.55 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, fasting blood glucose, prop taste detection threshold, schizophrenia, variant creutzfeldt-jakob disease