rs3779810 chr8:100150188 G>A
- Sequence
agcaaaaacaaaatcaagagaaag[G/A]taggaggcagctgccccactgccc
- ASB in cell types
- 22RV1 (prostate carcinoma) WHIM12 (breast cancer) breast tumor
- ASB for transcription factors
- SMAD3_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD3_HUMAN | -0.79 | 2.22 | 1.00 | 0.57 | Weak Concordant | |||
| ANDR_HUMAN | 2.79 | n/a | 2.00 | -2.32 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Lung, Nerve_Tibial, Pituitary, Thyroid