rs3780440 chr9:98315875 G>A
- Sequence
ggaaggcacccactggccttacat[G/A]aggccagatttccaagcaccatgg
- ASB in cell types
- erythroid cells heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.41 | n/a | 2.00 | |||
| heart left ventricle | -1.56 | 1.95 | 1.00 |
Items per page:
1 – 2 of 2