rs3780542 chr9:104820499 G>A
- Sequence
ggaccctgcacatgagccccatgt[G/A]ttcactttagatgaggagggagca
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.98 | -3.90 | 1.50 | -1.53 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, chronic kidney disease, cystatin c in serum, hdl cholesterol, hdl in metabolic styndrome subjects without diabetes, ldl cholesterol change with statins, microalbuminuria, total cholesterol, total cholesterol change with statins, triglycerides