rs3780603 chr9:70406579 A>G
- Sequence
tttcaacaaaaagtggggcggaga[A/G]agagagccaggattgctcaaagac
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.87 | 0.04 | 2.10 | n/a | No Hit | |||
| CTCF_HUMAN | 1.09 | 0.54 | 1.07 | n/a | No Hit |
Items per page:
1 – 2 of 2