rs3781070 chr10:12782716 A>G
- Sequence
gaccagctgtgatctgagcgtcta[A/G]ccctggacacagatacctactggc
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia) transverse colon pancreas
- ASB for transcription factors
- CTCF_HUMAN FLI1_HUMAN MEIS2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.67 | 1.28 | 1.24 | n/a | No Hit | |||
| FLI1_HUMAN | 0.69 | 2.23 | 1.12 | n/a | No Hit | |||
| MEIS2_HUMAN | -1.62 | 2.55 | 2.00 | n/a | No Hit | |||
| IKZF1_HUMAN | -0.56 | 1.63 | 2.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in nonasthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in nonasthmatic participants), parkinsons disease