rs3782114 chr11:250886 C>T
- Sequence
ggaggtaagcgaacacccaggagc[C/T]actttgtctgtggtttcagatttt
- ASB in cell types
- neutrophils from periferal blood liver THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.28 | 1.63 | 2.00 | |||
| liver | 2.21 | -1.88 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 1.14 | 0.73 | 1.00 |
Items per page:
1 – 3 of 3