rs3782397 chr12:53986232 A>G
- Sequence
ggaggtgtcggccctgccccggcc[A/G]tgggtgctaaggcgggggcggtgc
- ASB in cell types
- BJ1-hTERT (Human fibroblast telomerase immortalized cell line) HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) esophagus squamous epithelium
- ASB for transcription factors
- EGR1_HUMAN ZN600_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | 0.01 | 3.43 | 1.00 | 1.94 | Weak Concordant | |||
| ZN600_HUMAN | 2.49 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Muscle_Skeletal, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg