rs3782614 chr12:5665937 G>A
- Sequence
ataacaaatgattaacgcacagaa[G/A]tggctggagttggcctccagaaca
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -1.84 | 1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als) age of onset, homa-b, neuroblastoma (brain cancer), resistance to kuru in aged women despite likely exposure