rs3783468 chr1:67686680 G>A
- Sequence
ctgattgtggatctgtggtaggtg[G/A]gggtcaggagggtggctgcctttg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ATF3_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | 0.10 | 1.14 | 1.83 | n/a | No Hit | |||
| MNT_HUMAN | -0.05 | 1.69 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence, parkinsons disease (pd)