rs3783637 chr14:54881400 C>T
- Sequence
ttaagatgttttgctttctaccac[C/T]tgtttgaaaaatttgtcctacaag
- ASB in cell types
- GM17942 (lymphoblastoid cell) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.34 | 0.51 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, amyotrophic lateral sclerosis (als), diastolic blood pressure (dbp), parkinsons disease, rheumatoid arthritis, systolic blood pressure (sbp), triglycerides, urinary free dopamine (nmol/d) in children, urinary free dopamine:creatinine in children, vitiligo
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood