rs3783641 chr14:54893421 T>A
- Sequence
ttacagtcctcatatagaaatcac[T/A]ggcaaatgagtcaggtggggaatg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 0.74 | -0.52 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | 1.67 | -1.44 | 1.00 |
Items per page:
1 – 2 of 2